|
|
|
|
|
|
Web Resources for Xenotilapia simaFishBase profile for Xenotilapia sima
http://www.fishbase.org/Summary/SpeciesSummary.cfm?&genusname=Xenotilapia%09%09&speciesname=sima www.fishbase.org/Summary/SpeciesSummary.cfm?&genusname=Xenotilapia%09%09&speciesname=sima: Similar pages Xenotilapia sima Ilangi - Cichlid Lovers Picture PageCichlid Lovers Tropical Fish. Xenotilapia sima Ilangi. Home. http://www.cichlidlovers.com/x_sima_ilangi.htm Photo Gallery - Cichlid Lovers Tropical Fish: Xenotilapia ochrogenys Ndole Bay. Xenotilapia ornatipinnis pearl. Xenotilapia papilio Mvuna Island. Xenotilapia sima Ilangi. Home New Africans Contact Us. http://64.95.130.5/Map/OccurrenceTSAMapList.cfm?ID=9180&GenusName=Xenotilapia&SpeciesName=sima Occurrence Map List: Xenotilapia sima List of Point Data from FishBase and BiOSC Include BiOSC data, ... Xenotilapia sima, 1992, -5.93, 29.90, MRAC 92081.2011, Exp. ... http://www.webcityof.com/miff1099.htm Master Index of Freshwater Fishes (X - Y): Ax:162, SL:192, B4:706, TF:8 1/94, AF:50 3/99, AF:55 10/00) Xenotilapia papilio cf (AL:) `Sandcichlide Sunflower-Xenotilapia` Xenotilapia sima (Boulenger 1899 ... http://www.webcityof.com/miff1084.htm Master Index of Freshwater Fishes (S - Satocheilichthys czerskii): ...ochrogenys Sandcichlide See Xenotilapia ochrogenys cf Ndole Sandcichlide See Xenotilapia ornatipinnis Sandcichlide See Xenotilapia sima Sandcichlide Sunflower ... http://www.fishhead.com/cgi-bin/showimg.pl?File=xen_sima_bur.jpg&Name=Xenotilapia+sima,+Burundi Exotic Tropicals' Photo Gallery: Exotic Tropicals' Photo Gallery Xenotilapia sima, Burundi. Reuse of this photo is forbidden. Back to Photo Gallery Index. http://www.fishhead.com/photos.htm EXOTIC TROPICALS Cichlid Photo Gallery. Quality cichlid ...: Lac, Burundi Xenotilapia ochrogenys, Burundi Xenotilapia ochrogenys, Ndole Bay, Zambia Xenotilapia papilio, Tembwe, Zaire Xenotilapia sima, Burundi Xenotilapia ... http://www.ciklid.se/forum/topic.asp?TOPIC_ID=6856 Nordiska Ciklidsällskapet: Hittade den här texten frÃ¥n ett ciklidblad anno 86 "Xenotilapia sima, Burundi- variant Xenotilapia sima importerades redan i vÃ¥ras, men kom dÃ¥ frÃ¥n ... http://www.tanganyika.ru/fishes/generos/xenot_sim.shtml ОпиÑ?ание Xenotilapia sima BOULENGER, 1899: Xenotilapia sima BOULENGER, 1899. ---- Cichlidae ----- Altolamprologus POLL, 1986 Asprotilapia BOULENGER, 1901 Astatotilapia PELLEGRIN ... http://www.tanganyika.ru/fishes/generos/xenotilapia.shtml Xenotilapia BOULENGER, 1899: формы брюшных плавников. [Типовой вид:] Xenotilapia sima. [Триба:] Ectodini [Краткое опиÑ?ание ... http://www.fishbase.org.ph/References/FBRefSummary.cfm?ID=26577&Fishbase=Yes Reference Citation: Citation: Takahashi, T. and K. Nakaya, 1997. A taxonomic review of Xenotilapia sima and X. boulengeri (Cichlidae; Perciformes) from Lake Tanganyika.. Ichthyol. ... http://www.fishbase.org.ph/xml/comnamesxml.cfm?genus=Xenotilapia&species=sima&type= Successful connection, 1 record(s) found. Xenotilapia sima 9180 ...: ...] > Successful connection, 1 record(s) found. Xenotilapia sima 9180 æ‰?鼻奇é?žé¯½ China Main Mandarin Chinese Vernacular http://www.tanganika.inet.pl/ryby/ectodini/x_sima.html Xenotilapia sima: Xenotilapia sima (Boulenger 1899) Ogólna charakterystyka: urzekajÄ…ca ryba o wydÅ‚użonym ciele i ogromnych, jaskrawożółtych oczach. ... http://filaman.uni-kiel.de/Country/CountrySpeciesSummary.cfm?Country=Zambia&Genus=Xenotilapia&Species=sima filaman.uni-kiel.de/Country/CountrySpeciesSummary.cfm?Country=Zambia&Genus=Xenotilapia&Species=sima: Similar pages Length-Frequency Analysis WizardLength-Frequency Analysis Wizard (Xenotilapia sima) Step 1: Introduction, FishBase. In the following you will be guided through an ... http://filaman.uni-kiel.de/report/LFAnalysis_step01.cfm?speccode=9180 << Xenotilapia sima >>: ...- [ Translate this page ]Página principal. Espécies do Lago de Malawi Xenotilapia sima. Tamanho: 12 cm. Alimentação: OnÃvoro. Ph: 7.8 a 8.5. Temperatura: 25º a 28ºC. ... http://www.abacca.hpg.ig.com.br/malawi.html << espécies do Lago de Malawi >>: ...- [ Translate this page ] ... Lobochilotes labiatus. Xenotilapia papilio. Melanochromis auratus. Xenotilapia sima. Melanochromis blue, Xenotilapia spilopterus. ..... ... http://www.c-u-w.net/fische/xenotilapia.htm Xenotilapia: Boulenger 1901) Xenotilapia ornatipinus (Boulenger 1901) -> Xenotilapia ornatipinnis Xenotilapia papilio (Büscher 1990) Xenotilapia sima (Boulenger 1899 ... http://www.cichlidae.com/articles/a179.php The Cichlid Room Companion - Babes In The Cichlid Hobby Tanganyika ...: ...brichardi Telmatochromis temporalis Tropheus moorii "rainbow" Variabilichromis moorii Xenotilapia flavipinnis Xenotilapia sima Xenotilapia spilopterus. ... http://www.cichlidae.com/articles/a112.php The Cichlid Room Companion - North Towards the Kaiser Again, Part ...: ...down. Among the sand between the big rocks scattered on the bottom of the lake and you could observe many Xenotilapia sima. Two ... http://www.tanganyika.nl/X_sima.html Tanganyika.nl - Xenotilapia sima: Xenotilapia sima. Lang niet alle soorten Xenotilapia zijn vissen die de bodem van het aquarium schoon houden door het zand op te ... http://www.tanganyika.nl/dagboek.html Tanganyika.nl - Dagboek Tanganyika: Ik merk dat regelmatig, zeker 's avonds als het licht uit is: ik loop dan langs de bak en een geschrokken Xenotilapia sima springt dan het water uit, tegen een ... http://www.cichlids.com/info/Fish_Index_Lake_Tanganyika Fish Index Lake Tanganyika :: cichlids.com: Xenotilapia longispinis ?Xenotilapia nigrolabiata ?Xenotilapia ochrogenys ?Xenotilapia ornatipinnis ?Xenotilapia papilio ?Xenotilapia sima ?Xenotilapia sp. ... http://freshaquarium.about.com/cs/fishspecies/a/commonb.htm Common Names of Freshwater Fish - B (page 1): Betta splendens (profile) Big Scale Tetra - Brycinus macrolepidotus Big-Eyed Synodontis - Synodontis pleurops Big-Eyed Xenotilapia - Xenotilapia sima Big-Mouth ... http://www.geocities.com/ciclideos/linkstanhanyika.htm Aquariofilia - CiclÃdeos - Lago Tanganyika: Sambia Xenotilapia longispinis Xenotilapia nigrolabiata Xenotilapia ochrogenys Xenotilapia ornatipinnis Xenotilapia papilio Xenotilapia sima Xenotilapia sp. ... http://www.geocities.com/ciclidos/articulos/multifasciatus2.htm Neolamprologus multifasciatus por Marc Puigcerver: ...- [ Translate this page ] ... esta especie puede no solamente mantenerse con otros CÃclidos de mayor tamaño (Opthalmotilapia ventralis, Xenotilapia sima, Cyprichromis microlepidotus ... http://www.jjphoto.dk/fish_archive/cich2.htm Freshwater Aquarium - Tanganyika Cichlids: ...flavipinnis Poll, 1985 Uk: Yellow Sand Cichlid Dk: (Cichlide). Xenotilapia sima Boulenger, 1899 Uk: Bigeyed Xenotilapia Dk: (Cichlide), http://www.aquarium-bbs.de/fisch/barsche/ci-x.htm Cichlid Info, Barsch Liste "X": ...- [ Translate this page ] ... 2010, Xenotilapia papillo, Büscher, 1990, Af. 561, Xenotilapia sima, Boulenger, 1898, Af. 1837, Xenotilapia spilopterus, Poll & Stewart, 1975, Af. ... http://www.funet.fi/pub/sci/bio/life/pisces/actinopterygii/perciformes/cichlidae/xenotilapia/ Xenotilapia: 1991 Xenotilapia ornatipinnis Boulenger, 1901 Xenotilapia papilio Bìscher, 1990 Xenotilapia sima Boulenger, 1899 Xenotilapia spiloptera ... http://www.akvaunion.dk/fopdr/FOPDR-X.HTM fopdr-X.htm: 8 25 Jan Hommel Nielsen 1980 Xenotilapia ochrogenys 8 30 Max P. Bjørneskov 1986 Xenotilapia ornatipinnis 6 40 Max P. Bjørneskov 1990 Xenotilapia sima 6 40 ... http://cichlid-forum.com/articles/species_list_tanganyika.php List of Lake Tanganyikan Cichlid Species: Xenotilapia nigrolabiata. Xenotilapia ochrogenys. Xenotilapia ornatipinnis. Xenotilapia papilio. Xenotilapia sima. Xenotilapia sp. "Katete". Xenotilapia sp. "Ndole". ... http://www.biosis.org.uk/ion/results.asp?seek=Xenotilapia%20sima Search results: Results. Request Details. Searching for : Xenotilapia sima. Search Results. ... Database. Organism Name, Group. Xenotilapia sima, Pisces. Search again. ... http://www.aquabeek.nl/images/2004_03_03/320x/Lake_Tanganjika.htm Aquabeek: Xenotilapia papilio Sunflower. Xenotilapia papilio Tembwe. Xenotilapia sima (Gold). Xenotilapia spilopterus Blue Zambia. Xenotilapia spilopterus Kipilli. ... http://www.zaphi.com/aqua/akvarierum.htm Aqua - malawiciklider, tanganyikaciklider, diskus och odling av ...: Metriaclima estherae Nya arter Dimidiochromis compressiceps Lamprologus ocellatus Nimbochromis livingstonii Xenotilapia sima Neolamprologus gracilis ... http://www.zaphi.com/aqua/bilder.htm Aqua - malawiciklider, tanganyikaciklider, diskus och odling av ...: Xenotilapia sima (3 MB) Följ den spännande jakten pÃ¥ smÃ¥djur i sanden med Xenotilapia sima. Metrialclima estherae (4 MB) Rödzebror... http://crab.hucc.hokudai.ac.jp:8080/keng/kfinddata.cgi?USERID=42696576027746742 ç™»éŒ²æƒ…å ±è¡¨ç¤ºãƒšãƒ¼ã‚¸: Res., 44 : 109-117 (1997)＊; Takahashi, T. and Nakaya, K. : "A Taxonomic Review of Xenotilapia sima and X. boulengeri (Cichlidae ; Perciformes) from Lake ... http://perso.wanadoo.fr/aquariophilie-facile/Pages/Base%20de%20donn%E9es/Base%20de%20donn%E9es%20poissons%20-%20Aquariophilie%20-%20facile%20UVXYZ.htm Base de données des poissons d'aquariophilie: ...- [ Translate this page ] ... Xenotilapia ochrogenys. 8.2. 22. 27°C. 11 cm. 100 L. Sèche. Incubateur buccal. PAS OK. Xenotilapia sima. 8.1. 21. 28°C. 18 cm. 200 L. Sèche. Incubateur buccal. PAS OK. ... http://www.duboisi.com/forum/ndp/Xeno_sima_ilangi.htm fish_display.htm: Xenotilapia sima "Ilangi Yellow" Added 10-6-03. Picture Credit: Bluechip Aquatics. Picture Info: Copyright, used with permission. GENERAL INFORMATION. ... http://planeta.terra.com.br/lazer/cmca/ciclideos.htm BIÓTIPOS: Sambia" Xenotilapia longispinis Xenotilapia nigrolabiata Xenotilapia ochrogenys Xenotilapia ornatipinnis Xenotilapia papilio Xenotilapia sima Xenotilapia sp. ... http://www.la-atlantida.com/9galerias/peces/ciclido/1framegral.htm ATLAS DE PECES LA ATLANTIDA - Galeria fotografica: ...- [ Translate this page ] ... Xenotilapia flavipinnis. Xenotilapia ochrogenys. Xenotilapia ornatipinnis. Xenotilapia sima. Xenotilapia spilopterus. VER POR NOMBRE COMÚN. Ã?cara azul. ... http://www.akvanet.dk/Artikler/opbygning_%20tanganyka.htm Opbygning af et Tanganyka akvarie: Gnathochromis permaxillaris, Spathododus sp. "red Zaire", Cyprichormis leptosoma "Azuri" og Xenotilapia sima. AltsÃ¥ skal der være ... http://santron.no/shop/Lagerliste.htm Santron - Lagerliste fisk pr. 5. april 2004: ...red", Kachese Red - Kanonfisk, L, 250,-. Tropheus, sp. "mpimbwe", Yellow Cheek, M, 200,-. Xenotilapia, flavipinnis, Kainda, M, 150,-. Xenotilapia, sima, XL, 200,-. Malawi, ... http://www.angelicus-terraqua.com/articles/cas_of_rock_isolation_eng.htm Angelicus: Terraqua,faune et flore: Mastacembelus zebratus X. 2 Sabulicol species. Xenotilapia ochrogenys ochrogenys XXX. Xenotilapia melanogenys XXX. Xenotilapia sima X. Xenotilapia sp. aff. ... http://www.zoopet.com/akvarium/artikel_visa.asp?NR=90 Zoopet.com - Allt om akvarium och akvariefiskar: NÃ¥gra arter som t.ex. Xenotilapia sima behöver minst 150 cm, medan andra som Microdontochromis tenuidentatus nöjer sig med ett mindre pÃ¥ ca 100 cm. ... http://lapforum.lap.hu/pageforum.php?action=pageonline&FID=327&AID=1465 Lap.hu Fórum: Lord, 2003-04-10 17:47:48 Válasz erre, (14). Igazából homoki sügereket keresnék, Xenotilapia Ochrogenys, Xenotilapia sima, Enantiopus melanogenis "kilesa". ... http://lapforum.lap.hu/pageforum.php?action=pageonline&FID=327&AID=1462 Lap.hu Fórum: Sziasztok. PolarX, 2004-04-24 14:54:34 Válasz erre, (88). Hi! Xenotilapia sima érdekelne (vagyis az egyik haveromat). Ha van vkinek, szóljon! Ãœdv: PolarX. ... http://www.fish-isj.jp/english/research4404.html The Ichthyological Society of Japan: A taxonomic review of Xenotilapia sima and X. boulengeri (Cichlidae; Perciformes) from Lake Tanganyika Tetsumi Takahashi and Kazuhiro Nakaya … 335. ... http://www.fish-isj.jp/publication/research4404.html 日本éšé¡žå¦ä¼š: A taxonomic review of Xenotilapia sima and X. boulengeri (Cichlidae; Perciformes) from Lake Tanganyika Tetsumi Takahashi and Kazuhiro Nakaya ... http://www.nrm.se/ve/pisces/acara/cichpu97.shtml Guide to South American Cichlidae: 1997 Publications and Taxa: 1997. A taxonomic review of Xenotilapia sima and X. boulengeri (Cichlidae; Perciformes) from Lake Tanganyika. Ichthyological Research, 44: 335-346. ... http://www.cf-e.de/aktuell/ak_besat.htm Cichlidenfreunde Emsbüren e: ...- [ Translate this page ] ... 600. 100x120x50. B.Borg. 8. Tanganjikasee. Sand. Schieferplatten. Vallisnerien. Xenotilapia Sima #. Opthalmotilaia boops kipilli. 450. 150x60x50. C.Korte. 9. Mittelamerika. ... http://www.cf-e.de/fis_vere/tanga/fi_tanga.htm Cichlidenfreunde Emsbüren e: ...- [ Translate this page ] ... Die Tiere sollten in größeren Gruppen mit einem Verhältnis von mindestens 2/4 gehalten werden. Xenotilapia sima. Größe: max. 17cm. ... http://www.akvaryumklubu.com/baliklar/cichlid/genel/liste_tanganyika.htm Ä°stanbul Akvaryum Klübü (Ä°SAK): ...ochrogenys (BOULENGER, 1914) ---- Xenotilapia ornatipinnis BOULENGER, 1901 ---- Xenotilapia papilio BÃœSCHER, 1990 ---- Xenotilapia sima BOULENGER, 1899 ... http://www.hotcichlids.com/displayinventory.aspx?C=JV forsale: EA. Tropheus Moorii Katoto sunspot, Yes, $12.00, EA. X. Ochrogenys Utinta, Yes, $10.00, EA. Xenotilapia Sima Ilangi yellow, Yes, $10.00, EA. ... http://www2.biology.ualberta.ca/jackson.hp/IWR/Regions/Africa/Lake_Tanganyika.php IWR: Regions: Africa: Lake Tanganyika: ...papilio Buscher 1990; Xenotilapia sima Boulenger 1899; Xenotilapia spilopterus Poll & Stewart 1975. Anabantidae: Ctenopoma muriei (Boulenger ... http://web.singnet.com.sg/~alexcas/Stock%20List.htm Wild Caught African Cichlids: ...$100ea $70ea. Xenotilapia flavipinnis "Yellow - Cape Mpimbwe", Xenotilapia sima "Utinta Bay", Last piece. Other New Stock of L.Tanganyikan Fishes. ... http://web.singnet.com.sg/~alexcas/article.htm Species, Habitat, and Behavior: ...for shelter. Some of the species found are: Xenotilapia sima, Grammatotria perspicax, and Cardiopharynx schoutedeni. Lobochilotes ... http://www.planetcichlid.com/priceMalawi.htm Planet Cichlid - Wild Malawi: Pseudosimochromis curvifrons, 1.25". 0. $9.00. Synodontis petricola, 1". 20. $14.00. Xenotilapia sima, 2+". 24. $16.00. Accessories. Spawning Pots, $5.00. ... http://bioweb.pasteur.fr/docs/doc-gensoft/bambe/Data/fish.dna 32 1044 # category-list=(1,2,3)* # ND2 of African cichlid (Kocher ...: GCCATTTCCGCCTTATTAACCCCC Xensi Xenotilapia sima (Ectodini) ATGAACCCTAACATCTTAGCCATCCTCCTCTTTGGCTTAGGCCTTGGCACAACAATTACA ... http://www.aqua-art.spb.ru/ryby/x.htm Ð?квариумные рыбы: XENOTILAPIA SIMA, КСЕÐ?ОТИЛЯПИЯ, 38-28. XENOTOCA EISENI, КСЕÐ?ОТОКÐ?, 9-74, 26-190, O-18, O'8-21, Ð?м3'93-42, 28-307, 36-196. ... http://www.aqua-art.spb.ru/ryby/kr.htm Ð?квариумные рыбы: КРИПТОПТЕРУС, KRYPTOPTERUS MACROCEPHALUS, 18-103, 26-110, O'4-4. КСЕÐ?ОТИЛЯПИЯ, XENOTILAPIA SIMA, 38-28. КСЕÐ?ОТОКÐ?, ... http://www.worldwide-fish.com/tangayika.htm World Wide Fish: Tropheus moori "Duboisi", € 12,50. Tropheus moori "Moliro", € 12,50. Tropheus nkonde "Bright Yellow", € 20,00. Xenotilapia sima "Gold", € 17,05. ... http://w3.enternet.hu/zumbi/halak/szotar.htm szótár: X. Xenomystus nigri – afrikai késhal, barna késhal. Xenotilapia sima - nagy szemű homoksügér. Xenotoca eiseni - Eisen pontyocska. ... http://www.mavicanet.ru/directory/rus/26626.html Xenotilapia - MavicaNET: Выделить Ñ?айт, Fish Link Central: Photos - Xenotilapia sima - English URL: http://www.fishlinkcentral.com/photo.hts?504. Aquarium Fish Photos. [eng]. ... http://www.destin-tanganyika.com/Poissons/index_poissontangapag5.htm presentation des poissons du lac Tanganyika, CICHLIDAE: ...- [ Translate this page ] ... Xenotilapia sima (Boulenger 1901). ... http://www.tropheus.com.pl/index.php?option=displaypage&Itemid=47&op=page&SubMenu= tropheus sc: Xenotilapia papilio sunflower Chituta, -, -, -. Xenotilapia papilio sunflower Isanga, -, -, -. Xenotilapia sima, -, -, -. Xenotilapia spilopterus, -, -, -. Advertisement. http://members.fortunecity.com/akvarijum/afrikanci/xenotilapia.htm Africki ciklidi: AFRIÈKI CIKLIDI. Xenotilapia. spiloptera. Xenotilapia Boulenger 1899. Xenotilapia sima Boulenger 1899. Original Description: Boulenger ... http://www.biologybrowser.org/cgi-bin/search/hyperseek.cgi?Terms=Xenotilapia%20sima Resources from www.BiologyBrowser.org: Home > Searched ... Any Term Entire collection. How we searched.... Optional: xenotilapia sima No links available for this search. ... http://scilib.univ.kiev.ua/volume.php?115175 Сервер періодичних видань::Каталог ...: K NAKAYA, T TAKAHASHI, A TAXONOMIC REVIEW OF XENOTILAPIA-SIMA AND XENOTILAPIA-BOULENGERI (CICHLIDAE, PERCIFORMES) FROM LAKE-TANGANYIKA, 00335-00346. ... http://www.cichlid.org/Fishname.html ACA - Index of Fish Names: ...ochrogenys Xenotilapia ornatipinnis Xenotilapia ornatipinnis "pearly" Xenotilapia papilio Xenotilapia papilio "Tembwe Zaire" Xenotilapia sima Xenotilapia sp. ... http://home20.inet.tele.dk/laus/rak.htm Ny side 1: Der gÃ¥r følgende fisk i akvariet: 1,4 Xenotilapia sima, en masse hanner og hunner af Cyprichromis leptosoma, Mpulungu, et par og en unge af Neolamprologus ... http://www.aquapport.de/l_tang.htm gattung/genus: Xenotilapia, papilio Chituta bay, 5-6, aquarium, +. Xenotilapia, sima Tansania, 4-5, aquarium, +. Xenotilapia, spiloptera Kasanga, 7-9, wild, ++. ... http://www.cichliden.info/Aquaristik/Artenliste.html Altolamprologus POLL,1986 Altolamprologus calvus (POLL, 1978) ...: 1951 Xenotilapia ochrogenys (BOULENGER, 1914) Xenotilapia ornatipinnis BOULENGER, 1901 Xenotilapia papilio BÃœSCHER, 1990 Xenotilapia sima BOULENGER, 1899 ... http://www.malawicichlidenzucht.de/tanganjikasee.html nichtmbuna: ...- [ Translate this page ] ... L, 79,00 €. Xenotilapia papilio, L, 55,00 €. Xenotilapia sima, L, 21,00 €. Xenotilapia spilopterus, L, 21,00 €. Nichtcichliden & Welse, ... http://weiko-gmbh.de/Afrikanische%20Zierfische.htm Afrikanische Zierfische: ...- [ Translate this page ] ... T 153. Xenotilapia flavipinnis "Isanga". T 154. Xenotilapia ochrogenys. 196. T 155. Xenotilapia sima. 193. T 156. Xenotilapia spec. "Katete". 188. T 157. Xenotilapia spec. ... http://tanganjikazucht.de/sites/reise03_2.html Reisebericht Herbst 2003 Tanganjikasee: ...- [ Translate this page ] ... 20 m. Wunderschöne Xenotilapia sima, Neolamprologus tretocephalus, Lepidolamprologus kendalli und Cyphotilapia frontosa kreuzten unseren Weg. ... http://www.aquaflight.co.uk/stock.htm stock: Kasanga £25.00 Tropheus sp Black Bulu Point(Cherry Spot) £25.00 Xenotilapia papilio Sunflower Cape Mpimbwe £45.00 ****Xmas Offer Xenotilapia sima Utinta Bay ... http://www.aquaflight.co.uk/availability.htm Availability: ...ochrogenys "Black spot dorsal - Kekese" Xenotilapia ochrogenys "Shower of sparks - Halembe" Xenotilapia ochrogenys "Utinta Bay" Xenotilapia sima "Utinta Bay ... http://www3.petfrd.com/forum/articles.php?action=viewarticle&artid=52 Petfrd.com - Articles - An introduction to Lake Tanganyika: Xenotilapia ochrogenys (Boulenger 1914) • Xenotilapia ornatipinnis Boulenger 1901 • Xenotilapia papilio Buscher 1990 • Xenotilapia sima Boulenger 1899 ... http://www.cichlidencentrum.de/neu.htm Cichliden-Centrum Pulheim: ...- [ Translate this page ] ... Pseudotropheus polit lions cove noch eine Rarität, 7 - 8 cm, LDA 33 / Snowball, 5 - 6 cm, Xenotilapia sima WFNZ, 10 - 12 cm, L 46 Zebraharnischwels, 3 - 4 cm, ... http://www.aquariana.be/artikels/tanganyi.htm Tanganyika: Tropheus, huisvesting, territorium, voeding, enz... Xenotilapia sima, Zandcichlide. Xenotilapia papilio 'Tembwe', Vlinders van het Tanganyikameer. ... http://fenice.tigem.it/srs6bin/cgi-bin/wgetz?-id+4xSuY1LlhLN+%5Bprints-AccNumber:PR01436%5D+-e Entry Page: ...tt; Q36240 NADH DEHYDROGENASE SUBUNIT 2 - XENOTILAPIA FLAVIPINNUS. tt; Q36255 NADH DEHYDROGENASE SUBUNIT 2 - XENOTILAPIA SIMA. tt ... http://specieslist.com/endangered/scientific_name/S/Sandelia_bainsii.shtml Sandelia bainsii: ...htm Master Index of Freshwater Fishes (S - Satocheilichthys czerskii): See Xenotilapia ornatipinnis Sandcichlide See Xenotilapia sima Sandcichlide Sunflower ... http://www.fish-forum.com/modules.php?name=Common_Names Fish-Forum.com - Common_Names: Betta - Betta splendens Big Scale Tetra - Brycinus macrolepidotus Big-Eyed Synodontis - Synodontis pleurops Big-Eyed Xenotilapia - Xenotilapia sima Big-Mouth ... http://dive-tanganyika.com/cichlids.htm Cichlid Press Safari - cichlids at Kalambo Falls Lodge: Simochromis diagramma; Telmatochromis brichardi; Tropheus moorii (Kalambo) also Marmalade cats; Xenotilapia flavipinnis; Xenotilapia sima; Xenotilapia spilopterus. ... http://www.aquashop.com.ua/st-tanganika.html Озеро Танганьика: КÑ?енотилÑ?пиÑ? (Xenotilapia sima Boulenger, 1898) - обитатель пеÑ?чаных биотопов озера, напоминает по ... http://www.akvariebladet.dk/galleri/cichlider/Tanganyikasoen/cichlide-tan.html Akvariebladet - Galleri - Cichlider: Jeg ved det godt!! Det ser ikke sÃ¥ godt ud i Exploren, SÃ¥ brug Netscape.... http://cichlids.cgr.harvard.edu/cichlidbase-cgi/cichlidbasequery.cgi?tribe=ectodini&genus=&species=&imagefield.x=0&imagefield.y=0 cichlidBase: Ectodini, Xenotilapia, ochrogenys, Ectodini, Xenotilapia, ornatipinnis, Ectodini, Xenotilapia, papilio, Ectodini, Xenotilapia, sima, Ectodini, Xenotilapia, spilopterus, http://www.geocities.jp/masupyon2000/DIARY1509.htm DIARY: ...ã?¨ã‚ªã‚¯ãƒã‚²ãƒ‹ã‚¹ï¼ˆXenotilapia ochrogenys）を区別ã?§ã??る人ã?¯å¤š ã??ã?¦ã‚‚ã€?シマ（Xenotilapia sima）ã?¨ãƒ–ーレンジェリ（Xenotilapia ... http://www.ciklid.org/ciklidbladet_artikel.asp?NR=7401&LOPNR=2 Nordiska Ciklidsällskapet: ...elongatus, Julidochromis marlieri eller Telmatochromis, sÃ¥ tycker jag bäst om Limnochromis auritus, Callochromis macrops macrops eller Xenotilapia sima. ... http://www.ciklid.org/ciklidbladet_artikel.asp?NR=8404&LOPNR=3 Nordiska Ciklidsällskapet: Ã¥trÃ¥värda arter har dÃ¥ importerats? Den som först hittade vägen upp till Norden var vad jag vet Xenotilapia sima. Denna art har en ... http://www.zona.ru/directory/ukr/26626.html Xenotilapia - MavicaNET: Âèä³ëèòè ñà éò, Fish Link Central: Photos - Xenotilapia sima - English URL: http://www.fishlinkcentral.com/photo.hts?504. Aquarium Fish Photos. [eng]. ... http://www.infobiogen.fr/db/index-acnuc/HOVERGEN_44/protein/index/SPECIES Search the web for further information on Xenotilapia sima Use this form to make suggestions, correct errors, and contribute/submit pictures or content for this species profile. |
